THE RAFFLES PROGRAMME
Biology Year 4 (2025)
Name: ______________________________ ( )
Class: 4___
Date of Submission: _________
Established in 1879
UNIT 4: INFECTIOUS DISEASES AND MOLECULAR GENETICS
WS4.3: Case Study on Gene Mutation - Sickle Cell Anaemia
Learning Outcomes
Gene Mutation
• Outline the relationships among DNA, genes and chromosomes.
 explain how a change in the sequence of the DNA nucleotide (base substitution) may
affect the amino acid sequence in a protein, and hence the phenotype of the organism,
e.g. sickle cell anaemia
Text pages 322 – 323, 402
Notes on sickle cell anaemia:
•
•
•
•
•
low oxygen supply in the body
presence of sickle cells in the blood (see Fig.1)
amount of sickle cells in the blood may vary according to the genotype
parasite causing Malaria requires normal red blood cells for its reproduction in blood
a common illness in regions, such as Africa where Malaria is prevails
Watch this video to see relationship between Sickle Cell Anaemia and Malaria:
https://www.youtube.com/watch?v=5cBpNE-k3TQ
Fig. 1 Sickle cells and normal red blood cells
1
Further studies reveal different haemoglobins are found in normal red blood cells and sickle cells as in
Fig. 2
Fig. 2
a) Using HbA for normal haemoglobin allele and HbS for “sickle cell” haemoglobin allele, state three
possible genotypes and phenotypes of individuals in human population:
Genotype
(i)
homozygous for the normal haemoglobin allele
(ii)
heterozygous
(iii)
homozygous for the sickle cell trait
2
Phenotype
The difference in haemoglobins can be traced back to a gene mutation at the haemoglobin gene.
Normal haemoglobin allele coding DNA sequence: 5’ GTGCACCTCACTCCTGAGGAG 3’
Sickle cell haemoglobin allele coding DNA sequence: 5’ GTGCACCTCACTCCTGTGGAG 3’
b) The _______ nucleotide has been substituted from _______ to _______.
c) With reference to Fig. 1, Fig. 2 and the genetic codon chart below, suggest an explanation to the
formation of fibrous haemoglobin.
Substitution of the _____________________________ with ______________________________ will
generate a sticky patch on the surface of the β-globin polypeptide resulting in different β-globin
polypeptides sticking together into ______________ protein instead of _______________ protein.
3
d) With reference to Fig.2, explain the effect of fibrous haemoglobin in human.
e) Derive the enduring understanding on how gene mutation affects phenotype
f)
Suggest and explain which genotype will predominate in areas where Malaria prevails.
Hb^AHB^s
Individuals with this genotype has a mild anaemia and will have se;ecyobe advantage to
survive and reproduce more than the other phenotypes as they have enough functiona;
red blood cells to carry oxygen around their body. The parasite of Malaria is not able to
reproduce so much within their body. Those sith HbA HbA will die of Malria as the
parasite will reproduce and destroy the red bllood cells which are needed for carrying
oxygen. Those with HbS HbS will die as they have little functional red blood cells to carry
oxygen around their body.
4